Applying the knowledge and understandings demonstrated in Feminisim Essay

Applying the knowledge and understandings demonstrated in Feminisim and postmoderinisim in a specidic research area - Essay Example If truth were told, more people in the United States now days work for companies owned and led by women than for the five hundred prime public companies. However, there still lies so much tension between men and women at work. Controversy rises on the difference issue that if men and women in actual fact lead in like chalk and cheese ways or on the difference in their view and making use of authority or on the difference in amount and type of sacrifices made by high-achieving men and women for the growth and prosperity of the company and themselves too. It is quite true that there exist dissimilarities between men and women in management style, though not in skills but only in approach. Million years of history at the office or in the living room cannot be ignored at all. The sidesplitting Broadway show by the Caveman has summed up the dissimilarity quite well that Men hunt while women gather. That is the reason why in the present day, discrimination are rising between men and women not only on place of work but also in every aspect of life. (Manning, 279) Womens short of advancement in moving up the corporate ladder is over and over again associated with a various types of job related separation in which lady managers of a company are downgraded to the entry level and some middle management positions, although are effectively barred from getting hold of higher paying positions within the company. The observable fact has been popularly written off as the "glass ceiling", which implies the lady managers despite the fact that remaining adequately close to see the next level, but are not permitted to reach it. Other popular subjects, such as the "mommy track" may as well be taken for consideration as another form of occupational or "job" prejudice. In both the cases, the company treats male and female workers in a

Swot Analysis and Gatorade Essay Example for Free

Swot Analysis and Gatorade Essay So team physicians got together and determined what exactly was the problem. The athletes suffered from a lack of electrolytes and carbohydrates, which was not being replenished with just water. The group of four physicians blended a drink that had the perfect balance of carbohydrates and electrolytes. The drink would prove to help the Gator football team perform better on the field, so naturally they called the drink â€Å"Gatorade. † What happened next was rather remarkable because the players started performing better. They finished with a record of 7-4 that season and the next season they finished with a record of 9-2, winning the Orange Bowl for the first time in school history. Eventually, the drink moved into the professional leagues and the first team to adopt it was the Kansas City Chiefs. The Chiefs had trouble practicing in the stifling heat of Missouri’s summer afternoons and they kept it on the sidelines the whole year. It resulted in the Chiefs beating the heavily favored Minnesota Vikings in Super Bowl VI. Soon it became popular to have Gatorade on the sidelines and it started the sports drink category. By 1985, Gatorade had expanded its research in sports science by building the Gatorade Sports Science Institute. The Institute allows them to better understand the human body, its needs during the stress of competition and how to improve their products. 1 Product Features Gatorade helps performance in organs such as the kidneys, stomach, lungs, muscles and most importantly the brain. By battling dehydration, Gatorade fights off noticeable thirst, muscle cramps, weakness, decreased performance, nausea, fatigue, headaches and loss of focus. Gatorade’s all-important aspect of hydrating people, has carbohydrates to maintain energy levels during exercise, which water does not. Gatorade has greatly expanded the sports drink category since its conception in 1965 with drinks such as â€Å"Gatorade Rain†, â€Å"Gatorade Fierce† and as seen on the left â€Å"Gatorade G2. † 2 Current Branding Strategy †¢ Sports being Gatorade’s biggest focus, they brand themselves as the best sports drink for an athlete trying to reach their peak performance. †¢ They have done this through source credibility, by gathering a group of athletes like Peyton Manning, Dwyane Wade, Derek Jeter, Kevin Garnett and Michael Jordan. All of these athletes are memorable and influential to kids and adults, but Jordan has the most impact. †¢ Jordan probably has the most source credibility of anyone in sports, having him on their side has certainly helped. Michael Jordan, one of the greatest basketball players ev er, certainly helped Gatorade sales with campaigns like â€Å"Be Like, Mike. † Dewyane Wade, a Marquette University alumni, has been with Gatorade since 2005 3 Demographic The demographics of the Gatorade target market are active males, aged 18 to 25. They can be students, just starting their career, or well-established, regardless of status the majority of them believe they are athletic. They grew up idolizing many different sports athletes and teams, which still have an influence. They make a very wide variety of incomes because Gatorade is inexpensive. It could be anywhere from $10,000 to $60,000. Education could vary also, most have at least high school level education and some have college experience. Their attitudes can vary a little, but most of them are competitive, care about sports and enjoy their perspective athletic endeavors. The average customer for Gatorade is about 18-25 These types of consumers may also be interested in other sport-related clothing and accessories. They maybe interested in items such as jerseys, hats, shoes or anything that will show off their allegiance to a team, sport or player. 4 Competition PowerAde is the main competition for Gatorade, others like All Sport exist, but they do not present a challenge to Gatorade. The brand of PowerAde has essentially the same target market as Gatorade; 18 to 24 year old males who are engaged in athletics. However, PowerAde appears to be looking for the trendier types of consumers.

Who Am I? Essay example -- Writing Education Essays

Who Am I? Today as I look back at the first paper that I wrote for this class, I see that it is not the type of paper that I usually write. It is not full of big, sophisticated words. Rather it is a paper that does what it is supposed to, explain in simple english my thoughts on the subject. Those thoughts are that today most college kids are whiners and students go to college because it is the norm. I also gave a couple of abstracts to these. I never really took a stand as to which of those pertained to me. But I think that they all do in a sense. In a way I am irresponsible. I leave stuff to the last minute, I cram, and I get a attitude and just say screw it. As for the metaphor part of the first paper, I do feel that I am a parent and the university is my child. This interpretation is sort of like a cartogram. A cartogram is a map that is distorted to a relationship between two distinctive regions. The regions in this case is the university and myself. This is distorted because the universi ty is much larger than me, and it takes care of me. The second metaphor that I pondered is a little more down to Earth. The university is our god, and if we do not give, we shalt not receive. All of these lead into who I am. In essence I am a hippocrate. I condemn the students who procrastinate, while I am one of the worst at procrastinating. Take this paper for example. I am sitting at my roommates computer, it's eight o'clock Tuesday night, and I'm drinking a whiskey-coke. I already mentioned the child/parent thing. The god part of it is the same, though. I feel I am a god. I can so all of this and still get the grades. At least that the way it seems to be. In actuality I tried it, and it didn't work. The person who wrote the paper is no... ...y writing, I do not see myself. I see someone that's pleasing the audience with what he writes, but not pleasing himself. I am not happy writing stuff that is drab and has to sense of commitment. But that is what has always been a requirement. I like writing this kind of paper better. A paper that I can write with some sort of enthusiasm, eventhough I am better at writing the other kind. Writing this way just makes me feel better. I don't know, call me kooky. In the first paper I wrote with a very prominent mask. But as the papers progressed, I think that I might have been starting to shed that mask a little. Maybe it was the different style of writing. Maybe it was just me. Maybe it was due to the E-mail discussion, where got to people with out even talking to them directly. I don't know. The experience has been really productive. I just hope I can keep it up.

Othello -Essay

Gender Overplay The representation and relationships of women in Venetian society in terms of ender relations and equality are explored throughout the play. The character of Ago, adopts the sexist and discriminatory attitudes towards women that was common In the patriarchal society of Venice. Ago was someone who thought women were Infinitely exploitable, dispensable objects and driven by sexual desire only- â€Å"That she may make, unmake, do what she list ‘even as her appetite shall play the god. (Act 3 Scene 3). As Ago soliloquies, the repetition of â€Å"make† emphasizes the view of the relentless nature to which women approach relationships that was adopted by the patriarchal society. The view that women were characterized in such a derogatory and disparaging fashion, articulates the discriminative societal views that were upheld in Venetian society. Similarly, Sago's characterization of women Is representative of the dominant societal view that women were Inferior and nonsensical beings.Interestingly, Emilie contrasts Sago's belief concerning the sexual desire of women by expressing her belief that men use women to satisfy their own sexual desire- â€Å"They are all but stomachs, and we all but food; / they eat us hungrily, and then when they are full/ they belch us. † (Act 3 Scene 4). With the use of a metaphor to express the exploitation of women, combined with figurative language, Email Illustrates the gender tensions and views of women existing In a pre-femaleness society of women's oppression.The gender tensions that were present In the Venetian society existed on a basis of assumptions, having been predetermined by central societal beliefs. The resolution of play necessitates the death of Desman and Emilie due to their anomalous attempts to usurp the Elizabethan chain- mite I'll not shed her blood/nor scar that whiter skin of hers than snow/yet she must die, else he'll betray all men. â€Å"(Act 5 Scene 2) The use of an assertiv e tone, combined with figurative language expresses the belief that women were represented as threats to Venetian patriarchal structure.Desman had set herself outside the bounds of accepted female behavior, and her death signifies a return to patriarchal control. Othello is a warning for those who that attempt to usurp their position in Venetian society. Those people, who endeavourer to challenge the Elizabethan chain of being, are punished for their actions. Othello continues to engage audiences through its exploration of gender power plays- perennial, universal concerns that transcend time Racial Overplay Racial tensions explored in Othello are perennial themes which continue to engage audiences.Othello is considered as the ‘outsider' as he comes from outside of Venice and ‘retains some of his alien origins. ‘ In entering into marriage with Desman, Othello is stepping outside his expected role in society and challenging the Venetian hierarchal ‘chain of bei ng power structure. The racial discrimination and views on interracial marriage are expressed through use of binary opposition, using the analogy of a black ram and white ewe to highlight the bridge that exists between Othello and Desman belonging to different racial backgrounds- â€Å"Even now, now, very now, an old black ram is tipping your white ewe. (Act 1 Scene 1). Bestial imagery is also used with anthropomorphism to convey the racial prejudice expressed by Abortion and also the wider Venetian societal views on race and interracial marriage. This view characterizes Othello and intern his racial background as being associated with something that has negative connotations attached to it- â€Å"old black ram†. Throughout the plays evolution, the audience witnesses as Othello absorbs the explicit racism and black imagery, resulting in self-hatred.This is communicated through use of allusion as Othello utilizes his own â€Å"blackness† to characterize himself as sava ge- â€Å"Her name, that was fresh/ as Din's visage, is now begrimed and black/as mine on face. † (Act 3 Scene 3). Othello reflects the Venetian racial elucidation that blackness was a representation of evil and iniquity. At the conclusion of the play, it is clear to the audience that Othello is completely immersed n the racial based discriminatory values that are upheld by Venetian society.Before ending his life Othello mentions ‘Turk†, expressing a view of himself as the enemy to Venice- â€Å"Where a malignant and turbaned Turk/beat a Venetian and traduced the state† (Act 5 Scene 2). The allusion to the Turkish emphasizes the comparison that Othello is making of himself to something savage and unrelenting. This communicates the depth to which Othello has allowed himself to be pervaded with the dominant racial societal views. Resolution to the social challenge could only come wrought the death and disgrace of those who attempt to usurp the Venetian Ã¢â‚¬Ë œchain of being power structure.Othello is a warning for those who attempt to usurp the Elizabethan chain of being power structure. Those people, who attempt to contravene the divinely constructed social order, are punished for their anomalous actions. Through extracting the perennial power relations of the play, a Marxist and Feminist paradigm can be adopted. Shakespearean domestic tragedy Othello continues to engage audiences through its exploration of race and gender power plays- universal concerns that transcend time and place.

Individualism vs Conformity

Individualism vs. Conformity The lives of human beings are centered around the thin blue line that separates conformity and individuality. Many times one is confused and rushed, and this line is drawn too short or too long, thus being too much of a conformist or an individual. The â€Å"individual,† in the American conception, is an independent and inventive agent, relatively autonomous and morally responsible to him or herself.A widespread of specific propositions concerning â€Å"human nature† was derived from this ethnocentric premise. While these cultural propositions are still maintained, at least on the ideal level, in reality a considerable degree of dependency and conformity has developed. Conformity is, in a sense, the remedy for isolation. In the opinion of many Americans, this trend threatens standards of individualism by personal property and product, decisions amongst American youth, and conformity as a whole.First and foremost since the beginning of time, men and women were ideally allowed to voice disagreement with the decisions and practices of the authorities, they were expected to choose the occupation of their preference and be self-supporting, and encouraged to follow their own convictions and beliefs. A number of regulations have been introduced, presumably guaranteeing security and consistency of economic well-being for all Americans; these include, for example, Social Security, Medicare, and other similar measures.However, claims are made that freedom is no longer clearly tied to a social system of private property and passive government. Aside from human property there is human production. In the industrial realm, modern technology and its efficiency have resulted in establishing norms and standards for production as well as consumption. Efficiency and expediency has always been of fascination to outside observers. In the course of this growing industrial efficiency and expediency, individualistic and creative participation in the production process has become greatly reduced for the vast majority of employees.There is even a question whether the product itself meets standards of individuality and uniqueness, since it has been mass-produced and is designed to suit the tastes of thousands of people. Secondly, American youth, on one hand, are brought up in the knowledge of American history, which includes many well-known and glorified examples of individualism and are encouraged to practice this â€Å"truly American† trait. On the other hand, however, American youth are constantly challenged to conform to national and patriotic standards requiring high degrees of conformity to majority opinion.There is a widespread public opinion which perceives an expression of independent individual thinking and believing but as subversive and â€Å"un-American† conduct. One is inclined to conclude that the original individualism is now at war with a strong emphasis on conformity. It appears then that th ere is a serious discrepancy between the American ideal of â€Å"rugged individualism† and its actual implementation. A teenager has to learn carefully that this blueprint for American individualism is not generalizable and that there are definite areas of limitations and prohibitions.The fact of non-generalizability destroys the simplicity and predictability of always responding in identical or similar ways, thereby complicating the learning process and rendering the behavioral blueprint. Conformity is some sort of a psychological shelter. If one does not know what to do and are scared, it is natural to follow the steps of others so that eventually one can find a group to take shelter in. Conformity is essential to life. Humans, being complex animals, live in a society that functions as a whole.If there is a mistake, the entire system may crumble. So, they are obligated to pay taxes and respect the law so that they can stay together as a whole. Conformity is perfectly natura l. Everyone naturally wants to belong to something bigger. They naturally want to be accepted by others. However, in modern terms this acceptance can only be obtained by going further than natural conformity and stepping into popular conformity. At that certain stage Americans tend to follow the same trends in style and personal taste, whether it is music, movies, or even morals.In conclusion, individuality, like conformity, is essential to life even though modern society may not appreciate its value. At one point Americans want to be different from all the rest in one way or another. So one might dress a bit differently and choose to do things that intrigue one another. And, for once, individuals might form our opinions based on what they really feel. However, sooner or later Americans are forced to curb their spontaneous desires so that society does not label everyone as eccentric or weird.Modern life is confusing, so sometimes the vision is blurred and the choices, made in the mi dst of confusion, may force people in extreme directions of either conformity or individuality. Many Americans may follow everyone in everything they do, or may so much of an individual that they become somewhat of a hermit. Yet the trends that threaten standards of individualism by personal property and product, decisions amongst American youth, and conformity as a whole may show a sign of weakness. However, conformity may dominate the lives of Americans, but there is always the chance to make a mark, to become more of an individual than a clone.

Mideival Cooking essays

Mideival Cooking essays Cooking in the medieval times was performed on very big scale, and food was cheap and plentiful. Foreign goods had to be bought at the nearest large town. Food trade was a primary business. It was also a way of determining class. The nobles would eat meat, white bread, pastries, and drink wine. This sort of diet caused many health problems, such as skin troubles, digestive disorders, infections from decomposed proteins, scurvy, and tooth decay. A peasant would eat porridge, turnips, dark bread, and in the north they would drink beer or ale. Women were the expert cooks, and they seasoned their food heavily with pepper, cloves, garlic, cinnamon, vinegar, and wine. They paid close attention to the appearance of their meal. For instance, they might spread the feathers of a peacock that they are serving. Also, if a the eggs of a batter didnt make it yellow enough, they would add saffron (saffron is orange of yellow powder obtained from the stigmas of the saffron flower). Meat was expensive, so it was considered a luxury. This made butchers prosperous. The most common and least expensive was sheep. They would also eat birds: gulls, herons, storks, swans, cranes, cormorants, and vultures, just to name a few. Animals were cut up immediately after killing and salted to be preserved. Most meat was boiled because it the animals were wild, and the meat was sure to be tough. Also, almonds were often cooked with the meat for flavor. Fish was also popular. Part of this was because the church required that you eat fish on Fridays. Fish was often cooked in ale. People spent more on bread and grain then anything else, even though England had a national bread tax, which fixed the price of bread. Pastries were expensive because sugar was an import. Because medical opinion advised that fruit shouldnt be eaten raw, it was preserved in honey and cooked into pastries. Almonds were often cooked into pastries as well. Fruit was more wild back ...

Phenylalanine hydroxylase (PAH) Gene Essay Example

Phenylalanine hydroxylase (PAH) Gene Essay Example Phenylalanine hydroxylase (PAH) Gene Paper Phenylalanine hydroxylase (PAH) Gene Paper Phenylalanine hydroxylase (PAH) Gene Background: Phenylalanine hydroxylase (PAH) encodes the liver-secreted enzyme of the same name, a catalyst for the hydroxylation of tyrosine from phenylalanine, a rate-limiting step in the catabolism of the latter. This reaction only occurs in the presence of the cofactor tetrahydrobiopterin (BH4) as well as molecular oxygen and iron (1). Mutations in the PAH gene are generally caused by a change of an amino acid, for example, the change of arginine to tryptophan (2, 3). The numerous possible mutations in this gene result in a lack of enzyme activity. Thus, because of its main function, the deficiency in the activity of PAH causes a marked intolerance of the consumption of phenylalanine, an essential amino acid. This causes phenylketonuria (PKU), non-phenylketonuria hyperphenylalaninemia (non-PKU HPA), mild hyperphenylalaninemia (MHP), and other variant PKU (4, 5, 6). Defects in the PAH gene leads to the deficiency or the disruption of the production of the PAH enzyme; this is most commonly related to the resulting disorder, phenylketonuria. PKU is an autosomal, inborn, recessive disorder of phenylalanine metabolism (7). There are three common types of PKU. First, there is classical PKU, caused by the mutation of both alleles of the PAH gene in chromosome 12 which results in a severe deficiency or complete absence of the PAH enzyme, leading to toxic levels of unhydroxylated phenylalanine, typically over 10 times higher than normal concentrations (i.e. over 1000  µmol compared to the normal 100  µmol). Next, there is MHP, the mildest form of the PAH enzyme deficiency, with phenylalanine levels below 600  µmol but above normal. Thirdly, there is non-PKU HPA, caused by mutations in the PAH locus that hinder BH4 synthesis and regeneration. This relatively milder form of the disorder often results in heterozygous cases through a combination of mi ld and severe mutations (4, 7, 8). Severe classical PKU, if left untreated, is commonly known to result in the impedance of postnatal cognitive development causing mental retardation and in metabolic abnormalities causing increased phenylalanine in in the blood circulation and phenylpyruvic acid in the urine. PKU has also been known to cause skin abnormalities, organ damage, different kinds of posture peculiarities, pregnancy problems (maternal PKU), an odor describe as â€Å"mousy†, as well as other mental issues such as epilepsy, hyperactivity, and psychotic episodes (1,4,7,8). The most common negative effect associated with PKU, mental retardation, is caused by a neurotoxic effect of HPA. And while PKU is an inherited disorder, its negative effects could also be induced in the offspring of mothers with PKU, resulting not only in high fetus mortality rates but also in a high probability that the children are born with growth and mental retardations as well as malformations. This is known as PKU embryofetopath y or maternal PKU syndrome (8). Conversely, children born with non-PKU HPA and MHP have marked lower risks of being affect with the adverse effects of the disorder and can have normal development mentally and physically even with the absence of treatment (4,8). Despite the severe potential effects of classical PKU, newborn screening for high levels of phenylalanine has helped early diagnosis of the disorder, which is then followed by rapid treatment. Dietary restrictions of phenylalanine has been used for early treatment of PKU which, while not necessarily lead to complete normalization of IQ, was shown to be predictive of overall IQ with the complete lack of treatment in classical PKU patients leading to severe and irreversible cognitive retardation.(1,8) Thus, primary screening of neonates and children as well as awareness of the disorder for the parents are essential (3, 6). Results and Discussion: PAH chromosomal map position and nearby genes: The location of the PAH gene is at chromosome 12. Its long arm (q) is comprised of 13 exons with an approximate length of 90 kb. Figure 1 Chromosome 12 (9) Figure 1, above, is a representation of the entire chromosome 12 with both its short arm (p) and long arm (q) as it appears in the Ensembl website, albeit cropped to fit the page. This figure can be found by searching for the PAH gene and clicking on the â€Å"Location† link on the PAH listing. The website lists the location of the gene to be at â€Å"Chromosome 12: 103,232,104-103,311,381 reverse strand.†(2) Though the website does not explicitly state where in chromosome 12 PAH is located, one can infer additional details from the provided images. For example, confusion can ensue from the fact that the indicated location in the image in the Ensembl website is on the long arm on q23.2, while previous sources have stated that it is located on q22-24.2. However, from the code in the location and the additional images, one can infer that these are the transcribed portions of the gene, two of which are illustrated in the site. Furthermore, one can see that the PAH gene is flanked by the genes insulin-like growth factor 1 (IGF1), or somatomedin C, and achaete-scute complex homolog 1 (ASCL1). To obtain the information, though, one needs to explore the interactive image (see Figure 2 below) and go to the individual pages of the neighbor genes. Figure 2 Detailed view of region near PAH (9) The NCBI website, however, while very extensive in details, and containing multiple transcripts pertaining to the PAH gene, can be somewhat confusing with regard to the Map Viewer. Going through the home page and directly searching for the desired gene results in a very large and confusing map, with the details of the gene and its neighboring gene beyond the page to right. For a beginner who is not quite sure what to look for, the NCBI Map Viewer can be very overwhelming. Focusing on the table and not the map, however, one can see that the PAH gene is located in Chromosome 12, in the long arm q22-q24.2; this information is under the heading â€Å"Cyto† (for cytogenic) and stated as â€Å"12q22-q24.2† (10). Again, this might not be immediately clear to a beginner. Furthermore, the different master map options (Morbid, Gene_cyto, etc.) individually show different arrangements of the symbols, not all of which seem to be genes. Thus, it is very hard to decipher which genes are actually near PAH, although zooming in on the â€Å"Genes on Sequence† and â€Å"Phenotype† maps do reveal the proximity of IGF1 and ASCL1. In all, for a beginner, the Ensembl website proved to be much easier to use to answer the first question. The intron/exon structure of the PAH gene: It was very difficult to find an illustration of the structure of the PAH gene in the NCBI website. However, the information page for the gene stated that the gene spans 90 kb with the entire sequence and its adjacent regions a total of 171 kb. Furthermore, it states that the gene contains 13 exons, which consequently means that it has 12 introns (number of introns is one less than the number of exons) (1). After some searching, however, beginning with clicking the available links for PAH in the Map Viewer table, the link â€Å"sv† led to a page with the title â€Å"Homo sapiens chromosome 12 genomic contig, GRCh37 reference primary assembly.† Searching for the gene gives the following (zoomed-in and cropped) structure:   Figure 3 Structure of PAH gene (11) Though not obvious from the first glance, later we will see that the bottom sequence actually represents the structure of the PAH, with the vertical green lines representing the 13 exons. After further searching, the following (rotated) PAH structure showing the 13 exons and 12 introns can be found in the Map Viewer under â€Å"ensRNA†:   Figure 4 Another illustration of the structure of PAH gene (11) Finding those, however, takes previous explicit knowledge and some work to track down the specific illustrations. In contrast, finding the number of exons and introns and an illustration of the structure of the PAH gene in the Ensembl website was very straightforward. The following illustration can be found in the same page as Figure 1: Figure 5 Ensembl illustration of PAH gene structure This strand, one of the transcripts available in the Ensembl page, clearly shows the 13 exons in a DNA sequence. Comparing this structure to Figures 3 and 4, the numbers and the arrangements of the exons and introns are exactly the same. However, relative to all the tedious searching needed to find the same answers in the NCBI website, the information needed for the question was instantly available from the Ensembl site, and the interface was very easy to understand. Common PAH mutations: Mutations in general can refer to abnormalities in function or structure of the concerned enzyme in the gene phenotype. As previously discussed, however, such as the causes of PKU and HPA, the human PAH gene has displayed allelic differences and pathogenic transformations throughout its structure. The common types of mutations and their occurrence according to a previous study are: missense mutations with 62% of the alleles, small or large deletions with 13%, splicing defects with 11%, silent polymorphisms with 6%, nonsense mutations with 5%, and insertions with 2% of the PAH alleles. (6) Table1 PAH mutation statistics Mutation Type: # of Mutation(s) Missense 336 Deletion 73 Splice 62 Silent 32 Nonsense 28 Insertion 10 Sil./Splice 3 Unknown 3 Total mutations: 547 Most reported Mutation (Association): p.R408W (214) Missense, as can be seen above, is the most common cause of mutation in the PAH gene, the molecular mechanism of this is the improper folding of the protein structure, causing aggregation or degradation. As mentioned earlier, the mutations of PAH are commonly caused by single changes in the amino acid. One of the missense mutations, for example, occurs in E1 nucleotide 1 with the change of ATG to GTG. However, there is also missense mutation in region E3 with sequence 187.000 in nucleotide 187; this is called ACC/CCC;CAC/AAC. The second most common type of mutation is deletion. An example of deletion mutation is in regions E2-12 with sequence 168.001 in nucleotide 168. This is called GAG/GAA;G/A and has been noted to have occurred in Palestinians Arabs. (2, 3, 12)   Other examples can be seen in Appendix (I). As mentioned earlier, there are three common variations of PKU: classical PKU, MHP, and non-PKU HPA. These variations which are basically different degrees of severity of the disorder are caused by the different kinds of mutations that cause varying PAH activity as well as allelic variations. The latter effect at the locus of the gene determines the metabolic phenotype of the enzyme deficiency. In general, however, the mutations in the PAH gene are localized in a main part of the gene instead of being randomly distributed, as they occur either within or without the active site. What is interesting to note is that the PAH gene in intron 12 involves the single base change of guanine to adenine in the canonical 5-prime splice donor site where the first identified PKU mutation occurred. (3) Two out of the 6 links given by the Gene Gateway page were no longer working, one was solely dedicated to SNP, one was a link to a database that had links to other databases, and the last two were already explored thoroughly in previous parts of this assignment. The data presented in this section were mostly from the entire site dedicated to PAH gene mutations, the Phenylalanine Hydoxylase Locus Knowledgebase (5). This site, also a database, was arrived at after searching through the Locus Specific Mutation Databases which in turn arrived at from Human Genome Variation Society: Variation Databases and Related Sites. While the OMIM site did give some details about previous studies related to PAH gene mutations, they were more of a history of the mutations and examples of the studies. Finding the needed information was difficult because one needed to go through link after link and website after website, sometimes even arriving at the same website numerous times through different pathwa ys and still not obtaining any results. The PAHdb was by far, the only site that showed any data regarding the common mutations. Single nucleotide polymorphisms (SNPs) of the PAH gene: To date, 1220 SNPs for the PAH gene have been discovered, although GeneCards (2) states only 1097 from the NCBI website. In general, the SNPs involve the changing of a single base, as shown in Appendices I and II. Examples are the three found on exon 3, each of which has a single change of base, name cytocine, thiamine, and adeninine(13). Examples of these PAH gene SNPs are the rs63749677, rs63749676, rs63581460 and rs63499960; some of these are tabulated in Appendix (II). These SNPs are not randomly distributed as out of the 13 exons, they are seen in exons 1-7 and 12. Searching the NCBI website, however, resulted in 55 entries of SNPs with the following format: rs79931499 [Homo sapiens] CAATCCTTTGGGTGTATGGGTCGTAG[C/G]GAACTGAGAAGGGCCGAGGTATTGT 12 The above entry, an example of the results from the query in the NCBI SNP website, shows essential information about the SNP as well as options one can view. Compared to the other related links, which did not yield any useful information other than linking back to this site, the NCBI site dedicated purely to SNPs was simple and the information was easy to retrieve. Due to the very large number of SNPs, however, it would be difficult to evaluate all of them. Designing PCR primers: The given instructions and the program given in the website were rather straightforward, so the designing of the primer was the easiest part of the activity. The mRNA sequence was easily downloadable and the program was user-friendly (14). Being able to design primers this way was very fast and easy. The resulting primers are in Appendix (III). References: 1. [26/08/10]; Available from: ncbi.nlm.nih.gov/omim/612349 2. Hoeks M, den Heijer M, Janssen M. Adult issues in phenylketonuria. The Netherlands journal of medicine2009;67(1):2. 3. [21/09/09]; Available from: ensembl.org/index.html. 4. [26/08/10]; Available from: genecards.org/cgi-bin/carddisp.pl?gene=PAHsearch=pah#loc 5. [26/08/10]; Available from: pahdb.mcgill.ca. 6. Carter K, Byck S, Waters P, Richards B, Nowacki P, Laframboise R, et al. Mutation at the phenylalanine hydroxylase gene (PAH) and its use to document population genetic variation: the Quebec experience. European Journal of Human Genetics1998;6(1):61-70. 7.   [26/08/10]; Available from: ncbi.nlm.nih.gov/bookshelf/br.fcgi?book=gndpart=phenylketonuria 8. [26/08/10]; Available from: ncbi.nlm.nih.gov/bookshelf/br.fcgi?book=genepart=pku 9. [26/08/10]; Available from: ensembl.org/Homo_sapiens/Location/View?db=core;g=ENSG00000171759;r=12:103232104-103311381;t=ENST00000307000 10. [26/08/10]; Available from: ncbi.nlm.nih.gov/projects/mapview/maps.cgi?taxid=9606chr=12MAPS=pheno,morbid,genec,decode,ensrna,ensgenes,rnaRn,rnaMm,rnaHs,rnaGga,rnaBt,gbdna,rna,ugHs,genes-rcmd=focusfill=80query=uid(136508683,136446655,12845117,12579049,8990832,717234,698472,11088097,11049717,6481463,570698,568170,34586070,16320694,13572526,34590012,128619463,415205)QSTR=pah 11. [26/08/10]; Available from: ncbi.nlm.nih.gov/projects/sviewer/?id=NT_029419.12v=65375409..65454686 12. *Robin A Williams, 2 Cyril DS Mamotte,2 *John R Burnett1,3. Phenylketonuria: An Inborn Error of Phenylalanine Metabolism 13.  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚      [updated 21/09/09]; Available from: ncbi.nlm.nih.gov/SNP/snp_ref.cgi?locusId=5053 14.  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚      [21/09/09]; Available from: http://frodo.wi.mit.edu/cgi-bin/primer3/primer3_www.cgi Appendices: Appendix (I) Examples 1. Systematic Name: c.1AG Region: E1 Reference (1st): Mutation Name: p.M1V Sequence: 0.000 JOHN SW, ROZEN R, LAFRAMBOISE R, LABERGE C, SCRIVER CR: Novel PKU mutation on haplotype 2 in French-Canadians. Am J Hum Genet 45:905-909, 1989 Other Name: ATG/GTG Length: 1 Nucleotide No.: 1 Rest. Site: -Xba I Mutation Type: Missense Syst. Name gDNA: Date Entered: 1997-01-31 CpG/Fs/Pm: No/No/No 2. Systematic Name: c.3GA Region: E1 EIKEN HG, KNAPPSKOG PM, APOLD J, SKJELKVÃ…LE L, BOMAN H: A de novo phenylketonuria mutation: ATG (Met) to ATA (Ile) in the start codon of the phenylalanine hydroxylase gene. Hum Mut 1:388-391, 1992 Mutation Name: p.M1I Sequence: 3.000 Other Name: ATG/ATA Length: 1 Nucleotide No.: 3 Rest. Site: -NspI Mutation Type: Missense Syst. Name gDNA: Date Entered: 1997-01-31 CpG/Fs/Pm: No/No/No 3. Systematic Name: c.117CG Region: E2 FORREST SM, DAHL HH, HOWELLS DW, DIANZANI I, COTTON RGH: Mutation detection in phenylketonuria by using chemical cleavage of mismatch: Importance of using probes from both normal and patient samples. Am J Hum Genet 49:175-183, 1991 Mutation Name: p.F39L Sequence: 117.000 Other Name: TTC/TTG Length: 1 Nucleotide No.: 117 Rest. Site: -MboII, +MaeIII Mutation Type: Missense Syst. Name gDNA: Erlandsen H, Pey AL, Gmez A, Pà ©rez B, Desviat LR, Aguado C, Koch R, Surendran S, Tyring S, Matalon R, Scriver CR, Ugarte M, Martà ­nez A, Stevens RC.: Correction of kinetic and stability defects by tetrahydrobiopterin in phenylketonuria patients with certain phenylalanine hydroxylase mutations. Date Entered: 1997-01-31 CpG/Fs/Pm: No/No/No Appendix (II) SNPs of the PAH gene Region Contig position mRNA pos dbSNP rs# cluster id Hetero- zygosity Function dbSNP allele Protein residue Codon pos Amino acid pos exon_12 26716405 1750 rs59326968 N.D. synonymous C Asn [N] 3 426 contig reference T Asn [N] 3 426 exon_7 26728783 1314 rs5030851 N.D. missense T Leu [L] 2 281 contig reference C Pro [P] 2 281 exon_6 26731200 1061 rs5030653 N.D. missense (22bp) [CIKPMLAN] 1 197 frame shift -/TGTATAAAACCCATGCTTGCTA 1 197 contig reference (22bp) [LYKTHACY] 1 197 26731262 1020 rs17852373 N.D. missense G Gly [G] 2 183 contig reference A Glu [E] 2 183 exon_3 26770856 671 rs5030842 N.D. missense C Pro [P] 1 67 contig reference T Ser [S] 1 67 contig reference A Ser [S] 3 36 exon_1 26793098 474 start codon 1 Appendix (III) Designed Primers Exon1 ENSE00001141448 CAGCTGGGGGTAAGGGGGGCGGATTATTCATATAATTGTTATACCAGACGGTCGCAGGCT TAGTCCAATTGCAGAGAACTCGCTTCCCAGGCTTCTGAGAGTCCCGGAAGTGCCTAAACC TGTCTAATCGACGGGGCTTGGGTGGCCCGTCGCTCCCTGGCTTCTTCCCTTTACCCAGGG CGGGCAGCGAAGTGGTGCCTCCTGCGTCCCCCACACCCTCCCTCAGCCCCTCCCCTCCGG CCCGTCCTGGGCAGGTGACCTGGAGCATCCGGCAGGCTGCCCTGGCCTCCTGCGTCAGGA CAACGCCCACGAGGGGCGTTACTGTGCGGAGATGCACCACGCAAGAGACACCCTTTGTAA CTCTCTTCTCCTCCCTAGTGCGAGGTTAAAACCTTCAGCCCCACGTGCTGTTTGCAAACC TGCCTGTACCTGAGGCCCTAAAAAGCCAGAGACCTCACTCCCGGGGAGCCAGCATGTCCA CTGCGGTCCTGGAAAACCCAGGCTTGGGCAGGAAACTCTCTGACTTTGGACAG PCR primer design: No mispriming library specified Using 1-based sequence positions OLIGO  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚     Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  start   Ã‚  len   Ã‚  Ã‚  tm   Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  gc%   Ã‚  any     Ã‚  3  Ã‚  Ã‚  Ã‚  Ã‚     seq LEFT PRIMER  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚     Ã‚  369  Ã‚   20  Ã‚   59.83  Ã‚   55.00   6.00   2.00   Ã‚  TCCTCCCTAGTGCGAGGTTA RIGHT PRIMER  Ã‚  Ã‚  Ã‚  Ã‚     522  Ã‚   20  Ã‚   59.98  Ã‚   55.00   3.00   2.00   Ã‚  CAGAGAGTTTCCTGCCCAAG SEQUENCE SIZE: 533 INCLUDED REGION SIZE: 533 PRODUCT SIZE: 154, PAIR ANY COMPL: 4.00, PAIR 3 COMPL: 3.00 1 CAGCTGGGGGTAAGGGGGGCGGATTATTCATATAATTGTTATACCAGACGGTCGCAGGCT 61 TAGTCCAATTGCAGAGAACTCGCTTCCCAGGCTTCTGAGAGTCCCGGAAGTGCCTAAACC 121 TGTCTAATCGACGGGGCTTGGGTGGCCCGTCGCTCCCTGGCTTCTTCCCTTTACCCAGGG 181 CGGGCAGCGAAGTGGTGCCTCCTGCGTCCCCCACACCCTCCCTCAGCCCCTCCCCTCCGG 241 CCCGTCCTGGGCAGGTGACCTGGAGCATCCGGCAGGCTGCCCTGGCCTCCTGCGTCAGGA 301 CAACGCCCACGAGGGGCGTTACTGTGCGGAGATGCACCACGCAAGAGACACCCTTTGTAA 361 CTCTCTTCTCCTCCCTAGTGCGAGGTTAAAACCTTCAGCCCCACGTGCTGTTTGCAAACC 421 TGCCTGTACCTGAGGCCCTAAAAAGCCAGAGACCTCACTCCCGGGGAGCCAGCATGTCCA 481 CTGCGGTCCTGGAAAACCCAGGCTTGGGCAGGAAACTCTCTGACTTTGGACAG KEYS (in order of precedence): left primer right primer ADDITIONAL OLIGOS start   Ã‚  len   Ã‚  Ã‚  tm   Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  gc%   Ã‚  any     Ã‚  Ã‚  Ã‚  3  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚     seq 1 LEFT PRIMER  Ã‚  Ã‚  Ã‚  Ã‚     Ã‚  Ã‚  339  Ã‚   20  Ã‚   59.77  Ã‚   50.00   Ã‚  3.00   Ã‚  1.00  Ã‚  Ã‚     ACGCAAGAGACACCCTTTGT RIGHT PRIMER  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚   522  Ã‚   20  Ã‚   59.98  Ã‚   55.00   Ã‚  3.00   Ã‚  2.00   Ã‚  Ã‚  Ã‚  Ã‚  CAGAGAGTTTCCTGCCCAAG PRODUCT SIZE: 184, PAIR ANY COMPL: 6.00, PAIR 3 COMPL: 2.00 2 LEFT PRIMER  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚   318  Ã‚   20  Ã‚   59.32  Ã‚   55.00   4.00   2.00 GTTACTGTGCGGAGATGCAC RIGHT PRIMER  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚   522  Ã‚   20  Ã‚   59.98  Ã‚   55.00   3.00   2.00 CAGAGAGTTTCCTGCCCAAG PRODUCT SIZE: 205, PAIR ANY COMPL: 4.00, PAIR 3 COMPL: 2.00 3 LEFT PRIMER  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚   157  Ã‚   20  Ã‚   60.07  Ã‚   55.00   2.00   0.00 CTGGCTTCTTCCCTTTACCC RIGHT PRIMER  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚   337  Ã‚   20  Ã‚   59.32  Ã‚   55.00   4.00   3.00 GTGCATCTCCGCACAGTAAC PRODUCT SIZE: 181, PAIR ANY COMPL: 4.00, PAIR 3 COMPL: 1.00 4 LEFT PRIMER  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚   156  Ã‚   20  Ã‚   60.07  Ã‚   55.00   3.00   0.00 CCTGGCTTCTTCCCTTTACC RIGHT PRIMER  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚   337  Ã‚   20  Ã‚   59.32  Ã‚   55.00   4.00   3.00 GTGCATCTCCGCACAGTAAC PRODUCT SIZE: 182, PAIR ANY COMPL: 4.00, PAIR 3 COMPL: 2.00 Statistics con  Ã‚   too  Ã‚  Ã‚   in  Ã‚  Ã‚   in  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚   no  Ã‚  Ã‚   tm  Ã‚  Ã‚   tm   high   high  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚   high sid   many  Ã‚   tar   excl  Ã‚   bad  Ã‚  Ã‚   GC  Ã‚   too  Ã‚   too  Ã‚   any  Ã‚  Ã‚   3   poly  Ã‚   end ered  Ã‚  Ã‚   Ns  Ã‚   get  Ã‚   reg  Ã‚   GC% clamp  Ã‚   low   high compl compl  Ã‚  Ã‚  Ã‚   X   stab  Ã‚  Ã‚   ok Left  Ã‚  Ã‚   3637  Ã‚  Ã‚  Ã‚   0  Ã‚  Ã‚  Ã‚   0  Ã‚  Ã‚  Ã‚   0  Ã‚   162  Ã‚  Ã‚  Ã‚   0  Ã‚   419   2558  Ã‚  Ã‚  Ã‚   0  Ã‚  Ã‚  Ã‚   2  Ã‚  Ã‚   22  Ã‚  Ã‚   73  Ã‚   401 Right  Ã‚   3701  Ã‚  Ã‚  Ã‚   0  Ã‚  Ã‚  Ã‚   0  Ã‚  Ã‚  Ã‚   0  Ã‚   130  Ã‚  Ã‚  Ã‚   0  Ã‚   321   2817  Ã‚  Ã‚  Ã‚   0  Ã‚  Ã‚  Ã‚   2  Ã‚  Ã‚  Ã‚   0  Ã‚  Ã‚   78  Ã‚   353 Pair Stats: considered 140, unacceptable product size 129, high end compl 3, ok 8 primer3 release 1.1.4 KEYS (in order of precedence): left primer right primer ADDITIONAL OLIGOS start   Ã‚  len   Ã‚  Ã‚  tm   Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  gc%   Ã‚  any     Ã‚  3  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚     seq 1 LEFT PRIMER  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚   19  Ã‚   20  Ã‚   60.21  Ã‚   50.00   5.00   2.00   Ã‚  Ã‚  Ã‚  GCAGTGCCCTCCAGAAAATA RIGHT PRIMER  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚   265  Ã‚   20  Ã‚   58.12  Ã‚   40.00   3.00   0.00   Ã‚  TCAAAGATGACCCCAAAAGA PRODUCT SIZE: 247, PAIR ANY COMPL: 2.00, PAIR 3 COMPL: 0.00 2 LEFT PRIMER  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚   19  Ã‚   20  Ã‚   60.21  Ã‚   50.00   5.00   2.00  Ã‚     GCAGTGCCCTCCAGAAAATA RIGHT PRIMER  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚   260  Ã‚   22  Ã‚   60.05  Ã‚   40.91   4.00   0.00   Ã‚  GATGACCCCAAAAGATTTACCA PRODUCT SIZE: 242, PAIR ANY COMPL: 4.00, PAIR 3 COMPL: 1.00 3 LEFT PRIMER  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚   45  Ã‚   20  Ã‚   60.39  Ã‚   50.00   6.00   1.00  Ã‚     AGCCATGGACAGAATGTGGT RIGHT PRIMER  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚   265  Ã‚   20  Ã‚   58.12  Ã‚   40.00   3.00   0.00   Ã‚  TCAAAGATGACCCCAAAAGA PRODUCT SIZE: 221, PAIR ANY COMPL: 4.00, PAIR 3 COMPL: 1.00 4 LEFT PRIMER  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚   19  Ã‚   20  Ã‚   60.21  Ã‚   50.00   5.00   2.00   Ã‚  Ã‚  Ã‚  GCAGTGCCCTCCAGAAAATA RIGHT PRIMER  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚   258  Ã‚   20  Ã‚   57.92  Ã‚   40.00   4.00   0.00   Ã‚  TGACCCCAAAAGATTTACCA PRODUCT SIZE: 240, PAIR ANY COMPL: 4.00, PAIR 3 COMPL: 1.00 Statistics con  Ã‚   too  Ã‚  Ã‚   in  Ã‚  Ã‚   in  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚   no  Ã‚  Ã‚   tm  Ã‚  Ã‚   tm   high   high  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚   high sid   many  Ã‚   tar   excl  Ã‚   bad  Ã‚  Ã‚   GC  Ã‚   too  Ã‚   too  Ã‚   any  Ã‚  Ã‚   3   poly  Ã‚   end ered  Ã‚  Ã‚   Ns  Ã‚   get  Ã‚   reg  Ã‚   GC% clamp  Ã‚   low   high compl compl  Ã‚  Ã‚  Ã‚   X   stab  Ã‚  Ã‚   ok Left     Ã‚  7708  Ã‚  Ã‚  Ã‚   0  Ã‚  Ã‚  Ã‚   0  Ã‚  Ã‚  Ã‚   0  Ã‚   791  Ã‚  Ã‚  Ã‚   0   4562  Ã‚   600  Ã‚  Ã‚  Ã‚   0  Ã‚  Ã‚   14  Ã‚  Ã‚  Ã‚   0  Ã‚  Ã‚   52   1689 Right  Ã‚   7734  Ã‚  Ã‚  Ã‚   0  Ã‚  Ã‚  Ã‚   0  Ã‚  Ã‚  Ã‚   0   1269  Ã‚  Ã‚  Ã‚   0   4609  Ã‚   311  Ã‚  Ã‚  Ã‚   0  Ã‚  Ã‚  Ã‚   6  Ã‚  Ã‚  Ã‚   0  Ã‚  Ã‚   44   1495 Pair Stats: considered 2222, unacceptable product size 2195, high end compl 6, ok 21 primer3 release 1.1.4